Regex: match permutations of DNA sequence

Question

How do I make a regular expression to evaluate the following string?

TGATGCCGTCCCCTCAACTTGAGTGCTCCTAATGCGTTGC

and extract the pattern CTCCT.

The pattern must be 3 C's and 2 T's in any order.

I tried /[C | T]{5}/ but it matches CCCCT and TCCCC

Thanks in Advance.

Answer 1

This isn't the type of problem that is easily solved using Regular Expressions. It can be solved fairly straighforwardly with a simple function, however

 function c3t2(str) {
  var lowerCaseStr = str.toLowerCase();
  for (index = 0; index + 5 <= str.length; index++) {
    var substring = lowerCaseStr.substring(index, index + 5);
    var chars = substring.split("");
    if (chars.sort().join("") === "ccctt") {
      return index;
    }
  }

  return false;
}