How to visualize generated RNA secondary structure

Question

I'm working on a tool to visualize RNA secondary structure, for this purpose I have implemented Nussinov's algorithm which generates the RNA secondary structure as list with the corresponding indices, the code can be found here [0]

[0] http://dpaste.com/596262/

But I really stuck with understanding how I should visualize it (as a planar graph), the code above gives me a sequential list of the secondary structure, so can someone please suggest me as to how I can visualize the structure.An example of such tool can be found here [1]

[1] http://rna.tbi.univie.ac.at/cgi-bin/RNAfold.cgi

and I know there are better algorithms but for now I would just want to visualize with this and once I understand visualization, I will go for a better algorithm.

Answer 1

Visualizing the secondary structure of RNA (or any graph, for that matter) algorithmically is a difficult problem. You need to take care that there are as few overlaps as possible while maintaining consistent link lengths. As the other answers have pointed out, there are a number of existing implementations that you can already use. I'll just throw in another one that's quite easy to use and requires no downloads:

forna - nibiru.tbi.univie.ac.at/forna

Here you just need to enter a dotbracket string:

>molecule_name
CGCUUCAUAUAAUCCUAAUGAUAUGGUUUGGGAGUUUCUACCAAGAGCCUUAAACUCUUGAUUAUGAAGUG
((((((((((..((((((.........))))))......).((((((.......))))))..)))))))))

This will give you a visualization that looks something like this:

This is computed using a combination of the ViennaRNA RNAplot program and d3's force-directed graph algorithm.