parsing a fasta file using a generator ( python )

Question

I am trying to parse a large fasta file and I am encountering out of memory errors. Some suggestions to improve the data handling would be appreciated. Currently the program correctly prints out the names however partially through the file I get a MemoryError

Here is the generator

def readFastaEntry( fp ):
    name = ""
    seq = ""
    for line in fp:
        if line.startswith( ">" ):
            tmp = []
            tmp.append( name )
            tmp.append( seq )
            name = line
            seq = ""
            yield tmp
        else:
            seq = seq.join( line )

and here is the caller stub more will be added after this part works

fp = open( sys.argv[1], 'r' )

for seq in readFastaEntry( fp ) :
    print seq[0]

For those not fimilar with the fasta format here is an example

>1 (PB2)
AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATAC
TCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCC
TGCACTCAGGATGAAGTGGATGATG
>2 (PB1)
AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACC
ACATTTCCCTATACTGGAGACCCTCC

each entry starts with a ">" stating the name etc then the next N lines are data. There is no defined ending of the data other than the next line having a ">" at the beginning.

Answer 1

Have you considered using BioPython. They have a sequence reader that can read fasta files. And if you are interested in coding one yourself, you can take a look at BioPython's code.

Edit: Code added

def read_fasta(fp):
    name, seq = None, []
    for line in fp:
        line = line.rstrip()
        if line.startswith(">"):
            if name: yield (name, ''.join(seq))
            name, seq = line, []
        else:
            seq.append(line)
    if name: yield (name, ''.join(seq))

with open('f.fasta') as fp:
    for name, seq in read_fasta(fp):
        print(name, seq)

Answer 2

A pyparsing parser for this format is only a few lines long. See the annotations in the following code:

data = """>1 (PB2) 
AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATAC 
TCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCC 
TGCACTCAGGATGAAGTGGATGATG 
>2 (PB1) 
AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACC 
ACATTTCCCTATACTGGAGACCCTCC"""

from pyparsing import Word, nums, QuotedString, Combine, OneOrMore

# define some basic forms
integer = Word(nums)
key = QuotedString("(", endQuoteChar=")")

# sequences are "words" made up of the characters A, G, C, and T
# we want to match one or more of them, and have the parser combine
# them into a single string (Combine by default requires all of its
# elements to be adjacent within the input string, but we want to allow
# for the intervening end of lines, so we add adjacent=False)
sequence = Combine(OneOrMore(Word("AGCT")), adjacent=False)

# define the overall pattern to scan for - attach results names
# to each matched element
seqEntry = ">" + integer("index") + key("key") + sequence("sequence")

for seq,s,e in seqEntry.scanString(data):
    # just dump out the matched data
    print seq.dump()
    # could also access fields as seq.index, seq.key and seq.sequence

Prints:

['>', '1', 'PB2', 'AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCCTGCACTCAGGATGAAGTGGATGATG']
- index: 1
- key: PB2
- sequence: AATATATTCAATATGGAGAGAATAAAAGAACTAAGAGATCTAATGTCACAGTCTCGCACTCGCGAGATACTCACCAAAACCACTGTGGACCACATGGCCATAATCAAAAAGTACACATCAGGAAGGCAAGAGAAGAACCCTGCACTCAGGATGAAGTGGATGATG
['>', '2', 'PB1', 'AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACCACATTTCCCTATACTGGAGACCCTCC']
- index: 2
- key: PB1
- sequence: AACCATTTGAATGGATGTCAATCCGACTTTACTTTTCTTGAAAGTTCCAGCGCAAAATGCCATAAGCACCACATTTCCCTATACTGGAGACCCTCC