Logo Questions Linux Laravel Mysql Ubuntu Git Menu
 

Complement a DNA sequence

Suppose I have a DNA sequence. I want to get the complement of it. I used the following code but I am not getting it. What am I doing wrong ?

s=readline()
ATCTCGGCGCGCATCGCGTACGCTACTAGC
p=unlist(strsplit(s,""))
h=rep("N",nchar(s))
unlist(lapply(p,function(d){
for b in (1:nchar(s)) {    
    if (p[b]=="A") h[b]="T"
    if (p[b]=="T") h[b]="A"
    if (p[b]=="G") h[b]="C"
    if (p[b]=="C") h[b]="G"
}
like image 383
Anurag Mishra Avatar asked Dec 04 '13 09:12

Anurag Mishra


2 Answers

To complement, in both upper and lower case, you can use chartr():

n <- "ACCTGccatGCATC"
chartr("acgtACGT", "tgcaTGCA", n)
# [1] "TGGACggtaCGTAG"

To take it a step further and reverse complement the nucleotide sequence, you can use the following function:

library(stringi)

rc <- function(nucSeq)
  return(stri_reverse(chartr("acgtACGT", "tgcaTGCA", nucSeq)))

rc("AcACGTgtT")
# [1] "AacACGTgT"
like image 116
Megatron Avatar answered Sep 19 '22 23:09

Megatron


Use chartr which is built for this purpose:

> s
[1] "ATCTCGGCGCGCATCGCGTACGCTACTAGC"
> chartr("ATGC","TACG",s)
[1] "TAGAGCCGCGCGTAGCGCATGCGATGATCG"

Just give it two equal-length character strings and your string. Also vectorised over the argument for translation:

> chartr("ATGC","TACG",c("AAAACG","TTTTT"))
[1] "TTTTGC" "AAAAA" 

Note I'm doing the replacement on the string representation of the DNA rather than the vector. To convert the vector I'd create a lookup-map as a named vector and index that:

> p
 [1] "A" "T" "C" "T" "C" "G" "G" "C" "G" "C" "G" "C" "A" "T" "C" "G" "C" "G" "T"
[20] "A" "C" "G" "C" "T" "A" "C" "T" "A" "G" "C"
> map=c("A"="T", "T"="A","G"="C","C"="G")
> unname(map[p])
 [1] "T" "A" "G" "A" "G" "C" "C" "G" "C" "G" "C" "G" "T" "A" "G" "C" "G" "C" "A"
[20] "T" "G" "C" "G" "A" "T" "G" "A" "T" "C" "G"
like image 23
Spacedman Avatar answered Sep 21 '22 23:09

Spacedman